PSMD3 (NM_002809) Human 3' UTR Clone

CAT#: SC205446

3' UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 3 (PSMD3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PSMD3 (NM_002809) Human 3' UTR Clone
Vector pMirTarget
Synonyms P58; RPN3; S3; TSTA2
ACCN NM_002809
Insert Size 408 bp
Sequence Data
>SC205446 3’UTR clone of NM_002809
The sequence shown below is from the reference sequence of NM_002809. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAGAAGATGATGATGACAGCTTCCCTTGAGCTGGGGGGCTGGGGAGGGGTAGGGGGAATGGGGACAGG
CTCTTTCCCCCTTGGGGGTCCCCTGCCCAGGGCACTGTCCCCATTTTCCCACACACAGCTCATATGCTG
CATTCGTGCAGGGGGTGGGGGTGCTGGGAGCCAGCCACCCTGACCTCCCCCAGGGCTCCTCCCCAGCCG
GTGACTTACTGTACAGCAGGCAGGAGGGTGGGCAGGCAACCTCCCCGGGCAGGGTCCTGGCCAGCAGTG
TGGGAGCAGGAGGGGAAGGATAGTTCTGTGTACTCCTTTAGGGAGTGGGGGACTAGAACTGGGATGTCT
TGGCTTGTATGTTTTTTGAAGCTTCGATTATGATTTTTAAACAATAAAAAGTTCTCCACAGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002809.4
Synonyms P58; RPN3; S3; TSTA2
Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]
Locus ID 5709
MW 15.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...