PPP4C (NM_002720) Human 3' UTR Clone

CAT#: SC205397

3' UTR clone of protein phosphatase 4 (formerly X) catalytic subunit (PPP4C) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PPP4C (NM_002720) Human 3' UTR Clone
Vector pMirTarget
Synonyms PP-X; PP4; PP4C; PPH3; PPP4; PPX
ACCN NM_002720
Insert Size 344 bp
Sequence Data
>SC205397 3’UTR clone of NM_002720
The sequence shown below is from the reference sequence of NM_002720. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAAGCCCGTGGCCGACTACTTCCTGTGACCCCGCCCGGCCCCTGCCCCCTCCAACCCTTCTGGCCCT
CGCACCACTGTGACTCTGCCATCTTCCTCAGACGGAGGCTGGGCGTGGGGGGGGCTGTCCTGGCTCTGC
TGTCCCCCAAGAGGGTGCTTCGAGGGTGAGGACTTCTCTGGAGAGGCCTGGAGACCTAGCTCCATGTTC
CTCCTCCTCTCTCCCCACTTGAACCATGAAGTTTCCAATAATTTTTTTTTCTTTTTTTCCTTCTTTTTT
CTGTTTGTTTTTAGATAAAAATTTTGAGAAAAAAAATGAAAAAATTCTAATAAAAGAAGAAAAATGGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002720.3
Synonyms PP-X; PP4; PP4C; PPH3; PPP4; PPX
Summary Protein phosphatase that is involved in many processes such as microtubule organization at centrosomes, maturation of spliceosomal snRNPs, apoptosis, DNA repair, tumor necrosis factor (TNF)-alpha signaling, activation of c-Jun N-terminal kinase MAPK8, regulation of histone acetylation, DNA damage checkpoint signaling, NF-kappa-B activation and cell migration. The PPP4C-PPP4R1 PP4 complex may play a role in dephosphorylation and regulation of HDAC3. The PPP4C-PPP4R2-PPP4R3A PP4 complex specifically dephosphorylates H2AFX phosphorylated on Ser-140 (gamma-H2AFX) generated during DNA replication and required for DNA double strand break repair. Dephosphorylates NDEL1 at CDK1 phosphorylation sites and negatively regulates CDK1 activity in interphase (By similarity). In response to DNA damage, catalyzes RPA2 dephosphorylation, an essential step for DNA repair since it allows the efficient RPA2-mediated recruitment of RAD51 to chromatin.[UniProtKB/Swiss-Prot Function]
Locus ID 5531
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...