H2BC5 (NM_138720) Human 3' UTR Clone

CAT#: SC205367

3' UTR clone of histone cluster 1 H2bd (HIST1H2BD) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name H2BC5 (NM_138720) Human 3' UTR Clone
Vector pMirTarget
Synonyms dJ221C16.6; H2B.1B; H2B/a; H2B/b; H2B/g; H2B/h; H2B/k; H2B/l; H2BFA; H2BFB; H2BFG; H2BFH; H2BFK; H2BFL; HIRIP2; HIST1H2BC; HIST1H2BD; HIST1H2BE; HIST1H2BF; HIST1H2BG; HIST1H2BI
ACCN NM_138720
Insert Size 406 bp
Sequence Data
>SC205367 3' UTR clone of NM_138720
The sequence shown below is from the reference sequence of NM_138720. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACCAAGTACACCAGTTCCAAGTAACTTTGCCAAGGGAGAGACATGAAGACAGAGGAGAAATGAATGCAT
AAAATAACTGATAATATGAATCTATACATAGAACTTAGGAAGTCTCATCTGCCTGAAAATGACTGTGTGG
ATCCCACCCAAATCCAACTCATCCTGGTTTGCTGCACACTGGTTCATCAAAAGAAGGTTACCGAGGGGAA
GGAACTAAAGGTGTTTGCACTTCATGTTACTTTTTGAGTTTATAAACATAAAAACAGAATTTACTTCTGT
TACAGACCTAGTTACTGGGAATTCATTACTTGCCATGGACTACCTTTGCTAAGAAAAGTCTGAATGAGAA
GATGGCAGGACGTCTGAAAAAAAAAGTTATAATTAATAAAATCTGCGGAGAATTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138720.1
Synonyms dJ221C16.6; H2B.1B; H2B/a; H2B/b; H2B/g; H2B/h; H2B/k; H2B/l; H2BFA; H2BFB; H2BFG; H2BFH; H2BFK; H2BFL; HIRIP2; HIST1H2BC; HIST1H2BD; HIST1H2BE; HIST1H2BF; HIST1H2BG; HIST1H2BI
Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Two transcripts that encode the same protein have been identified for this gene, which is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]
Locus ID 3017
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...