ATP5F1D (NM_001687) Human 3' UTR Clone

CAT#: SC205334

3' UTR clone of ATP synthase H+ transporting mitochondrial F1 complex delta subunit (ATP5D) nuclear gene encoding mitochondrial protein transcript variant 1



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATP5F1D (NM_001687) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP5D; MC5DN5
ACCN NM_001687
Insert Size 418 bp
Sequence Data
>SC205334 3’UTR clone of NM_001687
The sequence shown below is from the reference sequence of NM_001687. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACGAGGCCCTGGTGAAGGCCCTGGAGTAGGCGGTGCGTACCCGGTGTCCCGAGGCCCGGCCAGGGGCT
GGGCAGGGATGCCAGGTGGGCCCAGCCAGCTCCTGGGGTCCCGGCCACCTGGGGAAGCCGCGCCTGCCA
AGGAGGCCACCAGAGGGCAGTGCAGGCTTCTGCCTGGGCCCCAGGCCCTGCCTGTGTTGAAAGCTCTGG
GGACTGGGCCAGGGAAGCTCCTCCTCAGCTTTGAGCTGTGGCTGCCACCCATGGGGCTCTCCTTCCGCC
TCTCAAGATCCCCCCAGCCTGACGGGCCGCTTACCATCCCCTCTGCCCTGCAGAGCCAGCCGCCAAGGT
TGACCTCAGCTTCGGAGCCACCTCTGGATGAACTGCCCCCAGCCCCCGCCCCATTAAAGACCCGGAAGC
CTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001687.5
Synonyms ATP5D; MC5DN5
Summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the delta subunit of the catalytic core. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Locus ID 513
MW 14.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...