ASXL1 (NM_001164603) Human 3' UTR Clone

CAT#: SC205289

3' UTR clone of additional sex combs like 1 (Drosophila) (ASXL1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ASXL1 (NM_001164603) Human 3' UTR Clone
Vector pMirTarget
Synonyms BOPS; MDS
ACCN NM_001164603
Insert Size 424 bp
Sequence Data
>SC205289 3’UTR clone of NM_001164603
The sequence shown below is from the reference sequence of NM_001164603. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGAATCAGCCTTTTCACGCTCAAGGTGTGAGCCACTGCACCAGGCCCCTTCATCTTAATTTTAATATAT
CTTTGAATAAACACCATTGTATGAACCTGCTGTAAGCTTGGGAGTGGTCTGTTAGTCTACAGCTTGTGT
CTGAGATGTGCTAATTGAATATTTGCTCAGTACCTCATCTTAACTGCCTTTGGCTTTATGTTGCTTATC
CTTCATAGTATCTTGTTCATTGGCCTTTTACATCCATAGGCATCACTTCTCTGATATTCGTTGTGCTCT
TTTAATGGATTAATGGTTTGCTTGGTTGGTTCCTCTAGTTAGACTGTAAACTCCTTGAGAGCAGAGTCT
GTATTTTATTAATTACCCACAGTACTAGGTACATAGTTGCCTTCAATAAATATATATTTAATGAAAAAA
AAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001164603.1
Synonyms BOPS; MDS
Summary This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Locus ID 171023
MW 15.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...