TAP1 (NM_000593) Human 3' UTR Clone

CAT#: SC205275

3' UTR clone of transporter 1 ATP-binding cassette sub-family B (MDR/TAP) (TAP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TAP1 (NM_000593) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1*0102N; TAP1N
ACCN NM_000593
Insert Size 400 bp
Sequence Data
>SC205275 3’UTR clone of NM_000593
The sequence shown below is from the reference sequence of NM_000593. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCAGGCTCCTGCAGATGCTCCAGAATGAAAGCCTTCTCAGACCTGCGCACTCCATCTCCCTCCCTTT
TCTTCTCTCTGTGGTGGAGAACCACAGCTGCAGAGTAGGCAGCTGCCTCCAGGATGAGTTACTTGAAAT
TTGCCTTGAGTGTGTTACCTCCTTTCCAAGCTCCTCGTGATAATGCAGACTTCCTGGAGTACAAACACA
GGATTTGTAATTCCTTACTGTAACGGAGTTTAGAGCCAGGGCTGATGCTTTGGTGTGGCCAGCACTCTG
AAACTGAGAAATGTTCAGAATGTACGGAAAGATGATCAGCTATTTTCAACATAACTGAAGGCATATGCT
GGCCCATAAACACCCTGTAGGTTCTTGATATTTATAATAAAATTGGTGTTTTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000593.6
Synonyms ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1*0102N; TAP1N
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where class I molecules assemble. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Locus ID 6890
MW 14.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...