ATP1A3 (NM_152296) Human 3' UTR Clone

CAT#: SC205266

3' UTR clone of ATPase Na+/K+ transporting alpha 3 polypeptide (ATP1A3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATP1A3 (NM_152296) Human 3' UTR Clone
Vector pMirTarget
Synonyms AHC2; ATP1A1; CAPOS; DYT12; RDP
ACCN NM_152296
Insert Size 385 bp
Sequence Data
>SC205266 3’UTR clone of NM_152296
The sequence shown below is from the reference sequence of NM_152296. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTTGGGTGGAGAAGGAAACCTACTACTGACCTCAGCCCCACCACATCGCCCATCTCTTCCCCGTCCCC
CAGGCCCAGGACCGCCCCTGTCAGTCCCCCCAATTTTGTATTCTGGGGGGAGGAGCCCTCTCTTCCTGT
GGCCCCACCTTGGCCCCCACCCCCTCCACTATCTCCTGCCGCCCCCACTCTGGCTGGCTTCTCTCCCCT
GCCCCAAACCTCTCTCCTCTCTCTTTTCTGTGTCAGTTTCTCTCCCTCTCCTCACCCCTCTATCCATTC
CTCCCGCCCCAGCCACCTCCCTGGGCTCTTTTTTACTCCCCTTCAGCCCCCCGGCTGATGCCATCTCTG
GTTCTGGACAATTATCAAATATATCAGTGGGGAGAGAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152296.5
Synonyms AHC2; ATP1A1; CAPOS; DYT12; RDP
Summary The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Locus ID 478
MW 14.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...