HLA-DRB1 (NM_002124) Human 3' UTR Clone

CAT#: SC205183

3' UTR clone of major histocompatibility complex class II DR beta 1 (HLA-DRB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HLA-DRB1 (NM_002124) Human 3' UTR Clone
Vector pMirTarget
Synonyms DRB1; HLA-DR1B; HLA-DRB; SS1
ACCN NM_002124
Insert Size 346 bp
Sequence Data
>SC205183 3’UTR clone of NM_002124
The sequence shown below is from the reference sequence of NM_002124. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGACTTCAGCCAACAGGATTCCTGAGCTGAAATGCAGATGACCACATTCAAGGAAGAACTTTCTGCCCC
GGCTTTGCAGGATGAAAAGCTTTCCTGCTTGGCAGTTATTCTTCCACAAGAGAGGGCTTTCTCAGGACC
TGGTTGCTACTGGTTCGGCAACTGCAGAAAATGTCCTCCCTTGTGGCTTCCTCAGCTCCTGCCCTTGGC
CTGAAGTCCCAGCATTGATGGCAGCGCCTCATCTTCAACTTTTGTGCTCCCCTTTGCCTAAACCGTATG
GCCTCCCGTGCATCTGTATTCACCCTGTATGACAAACACATTACATTATTAAATGTTTCTCAAAGATGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002124.4
Synonyms DRB1; HLA-DR1B; HLA-DRB; SS1
Summary HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and some alleles have increased frequencies associated with certain diseases or conditions. For example, DRB1*1302 has been related to acute and chronic hepatitis B virus persistence. There are multiple pseudogenes of this gene. [provided by RefSeq, Jul 2020]
Locus ID 3123
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...