Cytokeratin 5 (KRT5) (NM_000424) Human 3' UTR Clone

CAT#: SC205166

3' UTR clone of keratin 5 (KRT5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cytokeratin 5 (KRT5) (NM_000424) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK5; DDD; DDD1; EBS2; K5; KRT5A
ACCN NM_000424
Insert Size 397 bp
Sequence Data
>SC205166 3’UTR clone of NM_000424
The sequence shown below is from the reference sequence of NM_000424. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTCCTCCCGGAAGAGCTTCAAGAGCTAAGAACCTGCTGCAAGTCACTGCCTTCCAAGTGCAGCAACC
CAGCCCATGGAGATTGCCTCTTCTAGGCAGTTGCTCAAGCCATGTTTTATCCTTTTCTGGAGAGTAGTC
TAGACCAAGCCAATTGCAGAACCACATTCTTTGGTTCCCAGGAGAGCCCCATTCCCAGCCCCTGGTCTC
CCGTGCCGCAGTTCTATATTCTGCTTCAAATCAGCCTTCAGGTTTCCCACAGCATGGCCCCTGCTGACA
CGAGAACCCAAAGTTTTCCCAAATCTAAATCATCAAAACAGAATCCCCACCCCAATCCCAAATTTTGTT
TTGGTTCTAACTACCTCCAGAATGTGTTCAATAAAATGCTTTTATAATATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000424.4
Synonyms CK5; DDD; DDD1; EBS2; K5; KRT5A
Summary The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
Locus ID 3852
MW 14.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...