ZAP70 (NM_207519) Human 3' UTR Clone

CAT#: SC205145

3' UTR clone of zeta-chain (TCR) associated protein kinase 70kDa (ZAP70) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ZAP70 (NM_207519) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADMIO2; IMD48; SRK; STCD; STD; TZK; ZAP-70
ACCN NM_207519
Insert Size 392 bp
Sequence Data
>SC205145 3’UTR clone of NM_207519
The sequence shown below is from the reference sequence of NM_207519. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACACAGAAGGCTGAGGCTGCCTGTGCCTGAGCTCCCGCTGCCCAGGGGAGCCCTCCACGCCGGCTCTTC
CCCACCCTCAGCCCCACCCCAGGTCCTGCAGTCTGGCTGAGCCCTGCTTGGTTGTCTCCACACACAGCT
GGGCTGTGGTAGGGGGTGTCTCAGGCCACACCGGCCTTGCATTGCCTGCCTGGCCCCCTGTCCTCTCTG
GCTGGGGAGCAGGGAGGTCCGGGAGGGTGCGGCTGTGCAGCCTGTCCTGGGCTGGTGGCTCCCGGAGGG
CCCTGAGCTGAGGGCATTGCTTACACGGATGCCTTCCCCTGGGCCCTGACATTGGAGCCTGGGCATCCT
CAGGTGGTCAGGCGTAGATCACCAGAATAAACCCAGCTTCCCTCTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207519.2
Synonyms ADMIO2; IMD48; SRK; STCD; STD; TZK; ZAP-70
Summary This gene encodes an enzyme belonging to the protein tyrosine kinase family, and it plays a role in T-cell development and lymphocyte activation. This enzyme, which is phosphorylated on tyrosine residues upon T-cell antigen receptor (TCR) stimulation, functions in the initial step of TCR-mediated signal transduction in combination with the Src family kinases, Lck and Fyn. This enzyme is also essential for thymocyte development. Mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T-cells. Two transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 7535
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...