p18 INK4c (CDKN2C) (NM_001262) Human 3' UTR Clone

CAT#: SC205117

3' UTR clone of cyclin-dependent kinase inhibitor 2C (p18 inhibits CDK4) (CDKN2C) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name p18 INK4c (CDKN2C) (NM_001262) Human 3' UTR Clone
Vector pMirTarget
Synonyms INK4C; p18; p18-INK4C
ACCN NM_001262
Insert Size 394 bp
Sequence Data
>SC205117 3’UTR clone of NM_001262
The sequence shown below is from the reference sequence of NM_001262. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGCTGGGGGAGCCACAAATCTTCAATAAACGTGGGGAGGGCTCCCCCACGTTGCCTCTACTTTATCA
ATTAACTGAGTAGCTCTCCTGACTTTTAATGTCATTTGTTAAAATACAGTTCTGTCATATGTTAAGCAG
CTAAATTTTCTGAAACTGCATAAGTGAAAATCTTACAACAGGCTTATGAATATATTTAAGCAACATCTT
TTTAACCTGCAAAATCTGTTCTAACATGTAATTGCAGATAACTTTGACTTTCTTCTGAATATTTTATCT
TTCCTTGGCTTTTCCCTTGCTTCCCCTTTTGCCAATCTCAACACCCAAGTTGAAGACTTTGTTTTTAAA
ATGGTTTGTCCTGATGCTTTTGTCTAATTAAAACACTTTCAAAACAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001262.3
Synonyms INK4C; p18; p18-INK4C
Summary The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to interact with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. Ectopic expression of this gene was shown to suppress the growth of human cells in a manner that appears to correlate with the presence of a wild-type RB1 function. Studies in the knockout mice suggested the roles of this gene in regulating spermatogenesis, as well as in suppressing tumorigenesis. Two alternatively spliced transcript variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
Locus ID 1031
MW 14.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...