EWSR1 (NM_005243) Human 3' UTR Clone

CAT#: SC205109

3' UTR clone of Ewing sarcoma breakpoint region 1 (EWSR1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EWSR1 (NM_005243) Human 3' UTR Clone
Vector pMirTarget
Synonyms bK984G1.4; EWS; EWS-FLI1
ACCN NM_005243
Insert Size 390 bp
Sequence Data
>SC205109 3’UTR clone of NM_005243
The sequence shown below is from the reference sequence of NM_005243. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGTCAGGAGCGCAGAGATCGGCCCTACTAGATGCAGAGACCCCGCAGAGCTGCATTGACTACCAGATTT
ATTTTTTAAACCAGAAAATGTTTTAAATTTATAATTCCATATTTATAATGTTGGCCACAACATTATGAT
TATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATTAAAACAAGTTAAATGGTAGT
GTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAACAATGGGAACCCCTTG
TGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTCATGGTTGTGA
TGTTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005243.4
Synonyms bK984G1.4; EWS; EWS-FLI1
Summary This gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The protein includes an N-terminal transcriptional activation domain and a C-terminal RNA-binding domain. Chromosomal translocations between this gene and various genes encoding transcription factors result in the production of chimeric proteins that are involved in tumorigenesis. These chimeric proteins usually consist of the N-terminal transcriptional activation domain of this protein fused to the C-terminal DNA-binding domain of the transcription factor protein. Mutations in this gene, specifically a t(11;22)(q24;q12) translocation, are known to cause Ewing sarcoma as well as neuroectodermal and various other tumors. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and 14. [provided by RefSeq, Jul 2009]
Locus ID 2130
MW 15.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...