Cathepsin L (CTSL) (NM_001912) Human 3' UTR Clone

CAT#: SC205087

3' UTR clone of cathepsin L1 (CTSL1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cathepsin L (CTSL) (NM_001912) Human 3' UTR Clone
Vector pMirTarget
Synonyms CATL; CTSL1; MEP
ACCN NM_001912
Insert Size 392 bp
Sequence Data
>SC205087 3’UTR clone of NM_001912
The sequence shown below is from the reference sequence of NM_001912. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTCAGCAGCCAGCTACCCCACTGTGTGAGCTGGTGGACGGTGATGAGGAAGGACTTGACTGGGGATG
GCGCATGCATGGGAGGAATTCATCTTCAGTCTACCAGCCCCCGCTGTGTCGGATACACACTCGAATCAT
TGAAGATCCGAGTGTGATTTGAATTCTGTGATATTTTCACACTGGTAAATGTTACCTCTATTTTAATTA
CTGCTATAAATAGGTTTATATTATTGATTCACTTACTGACTTTGCATTTTCGTTTTTAAAAGGATGTAT
AAATTTTTACCTGTTTAAATAAAATTTAATTTCAAATGTAGTGGTGGGGCTTCTTTCTATTTTTGATGC
ACTGAATTTTTGTGTAATAAAGAACATAATTGGGCTCTAAGCCATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001912.5
Synonyms CATL; CTSL1; MEP
Summary The protein encoded by this gene is a lysosomal cysteine proteinase that plays a major role in intracellular protein catabolism. Its substrates include collagen and elastin, as well as alpha-1 protease inhibitor, a major controlling element of neutrophil elastase activity. The encoded protein has been implicated in several pathologic processes, including myofibril necrosis in myopathies and in myocardial ischemia, and in the renal tubular response to proteinuria. This protein, which is a member of the peptidase C1 family, is a dimer composed of disulfide-linked heavy and light chains, both produced from a single protein precursor. Additionally, this protein cleaves the S1 subunit of the SARS-CoV-2 spike protein, which is necessary for entry of the virus into the cell. [provided by RefSeq, Aug 2020]
Locus ID 1514
MW 14.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...