RWDD3 (NM_015485) Human 3' UTR Clone

CAT#: SC204979

3' UTR clone of RWD domain containing 3 (RWDD3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RWDD3 (NM_015485) Human 3' UTR Clone
Vector pMirTarget
Synonyms RSUME
ACCN NM_015485
Insert Size 385 bp
Sequence Data
>SC204979 3’UTR clone of NM_015485
The sequence shown below is from the reference sequence of NM_015485. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCGAATTTGTACTTGCTCTGGTAAAATGAAATGGAAGACAGGAATCTTTTAGTAAAATAGCAGTGTTT
TTTGTTGTTTTTGCATTGGATTTGGGGAGTGGTTAATTGAAATAGTCAATTTTAAAGTTTCTCTGAAGC
AAAATGATAGGCATCATTCTAACTTCAGGAACAAAAGCCAGTTCTGTTTTATGAAATATTAAACATGAA
GAAAACTTGTATATTCTAATGTTTGCCAGGAAAGGCTAGGTTCAGTAGATGAGACATTATTTAAAAGAT
AAATTTAAAAAGATGGTAAATGAACACTTGTTTTTATAGACAATATTTGTTTGAAACTATGTAATTTTC
TGGCTAATTTTCTTGTAATTAAATGATTTTTTAAAAAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015485.5
Synonyms RSUME
Summary Enhancer of SUMO conjugation. Via its interaction with UBE2I/UBC9, increases SUMO conjugation to proteins by promoting the binding of E1 and E2 enzymes, thioester linkage between SUMO and UBE2I/UBC9 and transfer of SUMO to specific target proteins which include HIF1A, PIAS, NFKBIA, NR3C1 and TOP1. Isoform 1 and isoform 2 positively regulate the NF-kappa-B signaling pathway by enhancing the sumoylation of NF-kappa-B inhibitor alpha (NFKBIA), promoting its stabilization which consequently leads to an increased inhibition of NF-kappa-B transcriptional activity. Isoform 1 and isoform 2 negatively regulate the hypoxia-inducible factor-1 alpha (HIF1A) signaling pathway by increasing the sumoylation of HIF1A, promoting its stabilization, transcriptional activity and the expression of its target gene VEGFA during hypoxia. Isoform 2 promotes the sumoylation and transcriptional activity of the glucocorticoid receptor NR3C1 and enhances the interaction of SUMO1 and NR3C1 with UBE2I/UBC9. Has no effect on ubiquitination.[UniProtKB/Swiss-Prot Function]
Locus ID 25950
MW 14.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...