HARS1 (NM_002109) Human 3' UTR Clone

CAT#: SC204970

3' UTR clone of histidyl-tRNA synthetase (HARS) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HARS1 (NM_002109) Human 3' UTR Clone
Vector pMirTarget
Synonyms CMT2W; HARS; HRS; USH3B
ACCN NM_002109
Insert Size 382 bp
Sequence Data
>SC204970 3’UTR clone of NM_002109
The sequence shown below is from the reference sequence of NM_002109. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAACAGGCCAGCCCCTCTGCATCTGCTGAACTGAACAAACTATCAGAGGAAAGGAAGTGGGACTGGCA
CTATTTGAGGTTAAGACAAACTGCATATGTACTTCAATTGCTTTGCACTTTTCCGTTTCAGCGGAAGAC
CTGAAGAGTGGTCAGAACAGAGCCTTTGATTTTTATTATGGTTATTTTATTGATTATTACTGGCAAAAA
CGGCCAGGTACAACACCTTTTTCATACAAGGCCCAGGAGGCTTAGTCCAGTCTGTGCTCCTGGGCTACA
AGGACCCAGCCTGAGATGGTCCCATCTGCAGGGCCCCGCACCAGTTGGAGCAGATGCCTCCCCACCACC
AATTGCCAAAGGTCCAATAAAATGCCTCAACCACGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002109.6
Synonyms CMT2W; HARS; HRS; USH3B
Summary Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Locus ID 3035
MW 14.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...