Transcription termination factor 1 (TTF1) (NM_007344) Human 3' UTR Clone

CAT#: SC204934

3' UTR clone of transcription termination factor RNA polymerase I (TTF1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 2 publications.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Transcription termination factor 1 (TTF1) (NM_007344) Human 3' UTR Clone
Vector pMirTarget
Synonyms TTF-1; TTF-I
ACCN NM_007344
Insert Size 397 bp
Sequence Data
>SC204934 3’UTR clone of NM_007344
The sequence shown below is from the reference sequence of NM_007344. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGGGAGGCCAAGGCCGGTGGATCATCTGAGGTCAGGAGTTCGAGACCGGCCTGACCAACATGGTGAAG
ACCTGTCACTATTAAAAATGCAAAAATTAGCCGGGTGTGGTAGTGCACACCTGTAATTTCAACTACTTG
GGAGGCTGAGGCAGGAGAATTGCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCCAAGATCGCACCACC
GCATGAGAGAGAGAGATTACTATTTCTTGTCCCTTTTTCTCAGTTTGATTATATTTATATACATATGTC
AGTAAATCTGTTTTCAGTATTGATGTTTAATAAAGAATGTACAATGGCCAGAGTTCTACTCTTTCCTCT
GGAGCATTAAAATATATTGCCATTCCTATTAAAACGTATTTGAATGTGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007344.4
Synonyms TTF-1; TTF-I
Summary This gene encodes a transcription termination factor that is localized to the nucleolus and plays a critical role in ribosomal gene transcription. The encoded protein mediates the termination of RNA polymerase I transcription by binding to Sal box terminator elements downstream of pre-rRNA coding regions. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene shares the symbol/alias 'TFF1' with another gene, NK2 homeobox 1, also known as thyroid transcription factor 1, which plays a role in the regulation of thyroid-specific gene expression. [provided by RefSeq, Apr 2011]
Locus ID 7270
MW 14.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Documents

其它Transcription termination factor 1产品

Customer Reviews 
Loading...