CACNA2D3 (NM_018398) Human 3' UTR Clone

CAT#: SC204918

3' UTR clone of calcium channel voltage-dependent alpha 2/delta subunit 3 (CACNA2D3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CACNA2D3 (NM_018398) Human 3' UTR Clone
Vector pMirTarget
Synonyms HSA272268
ACCN NM_018398
Insert Size 381 bp
Sequence Data
>SC204918 3’UTR clone of NM_018398
The sequence shown below is from the reference sequence of NM_018398. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCTGCTTTTGATGCTCTTCTCAAGGTGACACTGACTGAGATGTTCTCTTACTGACTGAGATGTTCTC
TTGGCATGCTAAATCATGGATAAACTGTGAACCAAAATATGGTGCAACATACGAGACATGAATATAGTC
CAACCATCAGCATCTCATCATGATTTTAAACTGTGCGTGATATAAACTCTTAAAGATATGTTGACAAAA
AGTTATCTATCATCTTTTTACTTTGCCAGTCATGCAAATGTGAGTTTGCCACATGATAATCACCCTTCA
TCAGAAATGGGACCGCAAGTGGTAGGCAGTGTCCCTTCTGCTTGAAACCTATTGAAACCAATTTAAAAC
TGTGTACTTTTTAAATAAAGTATATTAAAATCATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018398.3
Synonyms HSA272268
Summary This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Locus ID 55799
MW 14.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...