HAAO (NM_012205) Human 3' UTR Clone

CAT#: SC204913

3' UTR clone of 3-hydroxyanthranilate 34-dioxygenase (HAAO) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HAAO (NM_012205) Human 3' UTR Clone
Vector pMirTarget
Synonyms 3-HAO; h3HAO; HAO; VCRL1
ACCN NM_012205
Insert Size 378 bp
Sequence Data
>SC204913 3’UTR clone of NM_012205
The sequence shown below is from the reference sequence of NM_012205. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCCTGCCTGCAAGAAGCCCCTGGGGTGACCCTCTTGCCATGGCCTGAAGCAGCCACAGGTGTGCCAA
GCACCCTCGAGTGCCATCCCTGCCAAACAACTCTCCCAGCCCCCACTACCTCTCTGTGTACTGCCGCTG
TGTCCCCCACAGACCTGCACATTGTTGTCACCCACCCTCCTGCCCTTCTCAGCCCAGATGCCATGCCCC
TGGGCGGGCAGCAGCTCCCCATCTTCTCTGGCAGACTCAGCCCACTGCCTTGCCAGTCTTGCCAGGTGG
TCTACCCCCGGCCCCGCTCCTGCCCATTCCTCTGTCCCTGCAGACTCAGTGCAGCACTTCCACACCAAG
AAGGCCCTCAATAAAGGCTTCCTGAGGAACGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012205.3
Synonyms 3-HAO; h3HAO; HAO; VCRL1
Summary 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]
Locus ID 23498
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...