PLAUR (NM_001005376) Human 3' UTR Clone

CAT#: SC204851

3' UTR clone of plasminogen activator urokinase receptor (PLAUR) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PLAUR (NM_001005376) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD87; U-PAR; UPAR; URKR
ACCN NM_001005376
Insert Size 392 bp
Sequence Data
>SC204851 3’UTR clone of NM_001005376
The sequence shown below is from the reference sequence of NM_001005376. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGTGAGGAAGCCCAAGCTACTCATGTATAAATGCCATGTGGAGATAGAGCCCCAGATGTTTCAGCCATC
TCAGCCCAGGCACCAGACAAGTGGGTGAAGAAGCCACCTTGGACATGTAGCCCCAGCAGATGTGATATA
GAGAAGAAACAGGAAACTTGGCTATATTAGTTTCCTAGGGCTGCCTGTGATAAATTATTACAAACTTTA
TAAACTAACACATTGTGTGCCTATATCAAAACATCATGGAAGGACAGGCACAGTGGCTCATGCCTGTAG
TCCTAGCACTTTGGGAGGGTGAGAAAGGAAGATCTCTTGAGCTCAGGAGTTCAAGATCAGCCTGGGCAA
CACAGTGAGACCTCATCTCCACTAAAAATAAAAAAAAATTGGCTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001005376.3
Synonyms CD87; U-PAR; UPAR; URKR
Summary This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]
Locus ID 5329
MW 14.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...