SARS2 (NM_017827) Human 3' UTR Clone

CAT#: SC204832

3' UTR clone of seryl-tRNA synthetase 2 mitochondrial (SARS2) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SARS2 (NM_017827) Human 3' UTR Clone
Vector pMirTarget
Synonyms mtSerRS; SARS; SARSM; SerRS; SerRSmt; SERS; SYS
ACCN NM_017827
Insert Size 370 bp
Sequence Data
>SC204832 3’UTR clone of NM_017827
The sequence shown below is from the reference sequence of NM_017827. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGCTGCCTGGCCAGCCTGCTGTAAGCTAAGAACCCACCCACAGCAGCCCTCGGGGGTGTCACTGCTTC
CTGGAGTTCAGGAGACCCCGGACACCTGGGACCTGTGTTGCTGAGCCCGTCCTGACATCTGTGTTCTTC
CTGTCAGCTCCACGCCCGGGCCCCTGGACCACGGGGTCCACCTCTCCTCTGTCCTTGCTGCCTCAGAGT
CAGTCACTGACCCTGTTATCATTGAGGGTCCCAGTGGGAAGCAGGACGTCTGGGCTTTACGGTTCTAGG
GACAGGAGAAGCAGAGGAAGAGGCTTCCATCCCTCCTTCCTTCTTTCCTCCTACAGTGCTGAGCAAAAA
GTCCCCAATAAATGGTCAGGACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017827.4
Synonyms mtSerRS; SARS; SARSM; SerRS; SerRSmt; SERS; SYS
Summary This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
Locus ID 54938
MW 13.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...