CYP27A1 (NM_000784) Human 3' UTR Clone

CAT#: SC204814

3' UTR clone of cytochrome P450 family 27 subfamily A polypeptide 1 (CYP27A1) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CYP27A1 (NM_000784) Human 3' UTR Clone
Vector pMirTarget
Synonyms CP27; CTX; CYP27
ACCN NM_000784
Insert Size 293 bp
Sequence Data
>SC204814 3’UTR clone of NM_000784
The sequence shown below is from the reference sequence of NM_000784. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCCTGCAGTTCCTGCAGAGACAGTGCTGAGCTGAGTCTCCGCCTTGCTGGGGCTTGTCCTAGAGGCTC
CAGCTCTGGCACAGTGGTTCCTGGCTGCTGCCATGTCTCAGATGAGGAGGGAGAGAAGGAGGCCGCCAG
ACTCGAGAGGTGGGAGGAACTCCTTGCACACACCCTGAGCTTTTGCCACTTCTATCATTTTTGAGCAAC
TCCCTCTCAGCTAAAAGGCCACCCCTTTATCGCATTGCTGTCCTTGGGTAGAATATAAAATAAAGGGAC
TTTTATTTCTTATTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000784.4
Synonyms CP27; CTX; CYP27
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]
Locus ID 1593
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...