BYSL (NM_004053) Human 3' UTR Clone

CAT#: SC204765

3' UTR clone of bystin-like (BYSL) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BYSL (NM_004053) Human 3' UTR Clone
Vector pMirTarget
Synonyms BYSTIN; Enp1
ACCN NM_004053
Insert Size 370 bp
Sequence Data
>SC204765 3’UTR clone of NM_004053
The sequence shown below is from the reference sequence of NM_004053. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGAAGATGTTCCCATCACCGTGGAGTGAGGAAAACAGTCAGCTGTCCTGGCCAAAGGGGTTTGGAAG
GACACCAAGACCCCCGTTGGTGACTGAAGATGACACTGAGCTTTAATGGCTGAAGACCCAGATCAGGGC
AGTGACAGATCACAGGGACATCTGTGGCTCCCAGTCCAGGACAGGAAGGACTGAGGGTCTGGCTGGTTC
CCTCTTCCATTCTAGGCCCTTATCCCTGTTTAGTTCTGAGAGCCAACTTGAGATACCATATGCTAGCAT
TCCCAGTCCCCAGCTGGGGCTTGGTGTGAGTACTTTTTCTATGGCTATTGTGTCAGGTCACTGTGGATA
AAGGCAAAGACAGATATTTATTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004053.4
Synonyms BYSTIN; Enp1
Summary Bystin is expressed as a 2-kb major transcript and a 3.6-kb minor transcript in SNG-M cells and in human trophoblastic teratocarcinoma HT-H cells. Protein binding assays determined that bystin binds directly to trophinin and tastin, and that binding is enhanced when cytokeratins 8 and 18 are present. Immunocytochemistry of HT-H cells showed that bystin colocalizes with trophinin, tastin, and the cytokeratins, suggesting that these molecules form a complex in trophectoderm cells at the time of implantation. Using immunohistochemistry it was determined that trophinin and bystin are found in the placenta from the sixth week of pregnancy. Both proteins were localized in the cytoplasm of the syncytiotrophoblast in the chorionic villi and in endometrial decidual cells at the uteroplacental interface. After week 10, the levels of trophinin, tastin, and bystin decreased and then disappeared from placental villi. [provided by RefSeq, Jul 2008]
Locus ID 705
MW 13.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...