RNASEH2B (NM_024570) Human 3' UTR Clone

CAT#: SC204744

3' UTR clone of ribonuclease H2 subunit B (RNASEH2B) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RNASEH2B (NM_024570) Human 3' UTR Clone
Vector pMirTarget
Synonyms AGS2; DLEU8
ACCN NM_024570
Insert Size 318 bp
Sequence Data
>SC204744 3’UTR clone of NM_024570
The sequence shown below is from the reference sequence of NM_024570. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAAATAAAAAAAAAATTGGAAAGGTTTGAAACTTTGAAAATAAAATCTAGCAAAAATATTTGCTTTTT
ACATGTTTCAGTTTGTCCTTCCTGACTGTTAATGACTACCTTTGGTTGGGGGAAGGAAGAGGCCAATTT
CATGTTCTCTTAAACATTTCTTTGCATTTGGTTTTTGTGTTCCTGAACAAAATATGGGAAAGTGTCTAA
CTTCATGGCTATGGCCTTTTGGAGTCTCATCTGACATAATGAAAAGTAATCACTTGAAGAGAATTAACA
TATAGCATCATGATTTTCTCAATAAACTGATGTGTGACAATG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024570.4
Synonyms AGS2; DLEU8
Summary RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
Locus ID 79621
MW 12.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...