Eph receptor A1 (EPHA1) (NM_005232) Human 3' UTR Clone

CAT#: SC204717

3' UTR clone of EPH receptor A1 (EPHA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Eph receptor A1 (EPHA1) (NM_005232) Human 3' UTR Clone
Vector pMirTarget
Synonyms EPH; EPHT; EPHT1
ACCN NM_005232
Insert Size 358 bp
Sequence Data
>SC204717 3’UTR clone of NM_005232
The sequence shown below is from the reference sequence of NM_005232. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTTGCAGTATTCAGGGATTCAAGGACTGATCCCTCCTCTCACCCCATGCCCAATCAGGGTGCAAGGAG
CAAGGACGGGGCCAAGGTCGCTCATGGTCACTCCCTGCGCCCCTTCCCACAACCTGCCAGACTAGGCTA
TCGGTGCTGCTTCTGCCCACTTTCAGGAGAACCCTGCTCTGCACCCCAGAAAACCTCTTTGTTTTAAAA
GGGAGGTGGGGGTAGAAGTAAAAGGATGATCATGGGAGGGAGCTGAGGGGTTAATATATATACATACAT
ACACATATATATATTTTTGTAAATAAACAGGAACTGATTTTCTGCCTCCATCCCACCCATGAGGGCTGC
AGGCACTACAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005232.5
Synonyms EPH; EPHT; EPHT1
Summary This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
Locus ID 2041
MW 13.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...