PABPC4 (NM_001135654) Human 3' UTR Clone

CAT#: SC204690

3' UTR clone of poly(A) binding protein cytoplasmic 4 (inducible form) (PABPC4) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PABPC4 (NM_001135654) Human 3' UTR Clone
Vector pMirTarget
Synonyms APP-1; APP1; iPABP; PABP4
ACCN NM_001135654
Insert Size 350 bp
Sequence Data
>SC204690 3’UTR clone of NM_001135654
The sequence shown below is from the reference sequence of NM_001135654. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGGCGCTGTTGCTGCTGCTACCTCTTAGACAAGGAAAAACCGATTCAAAAGCCAAATAACCCCTTAT
GGAATTCAACTCAAGGTTTGAAGACTTCCTAGCTTGTCCTATGGACCTCAACACCAAGGATTACAAATT
GCAAATTTAATAGGTCATTTTGTATCAAAAGGTCAATTATGAAGCACCTAGAATTTTTCAATTATACGA
ATATGTTCTTTGGGTTCTGCTGTGGCCCAGACAGTGTTAACTTTTTTTTTATTGTGGGTTTTGATTTTT
TCCCCCAGAAATTGGTTTTATTTGATGTACCCAAGTCTTACGTTTCCCAATAAAGAAAAAAAATCTCCA
TAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135654.2
Synonyms APP-1; APP1; iPABP; PABP4
Summary Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Locus ID 8761
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...