COP1 (RFWD2) (NM_022457) Human 3' UTR Clone

CAT#: SC204688

3' UTR clone of ring finger and WD repeat domain 2 (RFWD2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name COP1 (RFWD2) (NM_022457) Human 3' UTR Clone
Vector pMirTarget
Synonyms CFAP78; FAP78; RFWD2; RNF200
ACCN NM_022457
Insert Size 352 bp
Sequence Data
>SC204688 3’UTR clone of NM_022457
The sequence shown below is from the reference sequence of NM_022457. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTACAATTAAGGTGCTAGAATTGGTATGAAGGGTTAACTCAAGTCAAATTGTACTTGATCCTGCTGAA
ATACATCTGCAGCTGACAATGAGAGAAGAAACAGAAAATGTCATGTGATGTCTCTCCCCAAAGTCATCA
TGGGTTTTGGATTTGTTTTGAATATTTTTTTCTTTTTTTCTTTTCCCTCCTTTATGACCTTTGGGACAT
TGGGAATACCCAGCCAACTCTCCACCATCAATGTAACTCCATGGACATTGCTGCTCTTGGTGGTGTTAT
CTAATTTTTGTGATAGGGAAACAAATTCTTTTGAATAAAAATAAATAACAAAACAATAAAAGTTTATTG
AGCCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022457.7
Synonyms CFAP78; FAP78; RFWD2; RNF200
Summary E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Involved in JUN ubiquitination and degradation. Directly involved in p53 (TP53) ubiquitination and degradation, thereby abolishing p53-dependent transcription and apoptosis. Ubiquitinates p53 independently of MDM2 or RCHY1. Probably mediates E3 ubiquitin ligase activity by functioning as the essential RING domain subunit of larger E3 complexes. In contrast, it does not constitute the catalytic RING subunit in the DCX DET1-COP1 complex that negatively regulates JUN, the ubiquitin ligase activity being mediated by RBX1. Involved in 14-3-3 protein sigma/SFN ubiquitination and proteasomal degradation, leading to AKT activation and promotion of cell survival. Ubiquitinates MTA1 leading to its proteasomal degradation. Upon binding to TRIB1, ubiquitinates CEBPA, which lacks a canonical COP1-binding motif (Probable).[UniProtKB/Swiss-Prot Function]
Locus ID 64326
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...