ERK5 (MAPK7) (NM_139033) Human 3' UTR Clone

CAT#: SC204635

3' UTR clone of mitogen-activated protein kinase 7 (MAPK7) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ERK5 (MAPK7) (NM_139033) Human 3' UTR Clone
Vector pMirTarget
Synonyms BMK1; ERK4; ERK5; PRKM7
ACCN NM_139033
Insert Size 343 bp
Sequence Data
>SC204635 3’UTR clone of NM_139033
The sequence shown below is from the reference sequence of NM_139033. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCACAGTAGACCTAGT
TCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAGCAGGTGAGGCTCGGCTTGGATT
ATTCTGCAGGTTCATCTCAGACCCACCTTTCAGCCTTAAGCAGCCACCTGAGCCACCACCGAGCCATGG
CAGGATCGGGAGACCCCAACTCCCCCTGAACAATCCTTTTCAGTATTATATTTTTATTATTATTATGTT
ATTATTACACTGTCTTTTTGCCATCAAAATGAGGCCTGTGAAATACAAGGTTCCCTTCTGCACCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_139033.3
Synonyms BMK1; ERK4; ERK5; PRKM7
Summary The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Locus ID 5598
MW 12.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...