RAMP1 (NM_005855) Human 3' UTR Clone

CAT#: SC204571

3' UTR clone of receptor (G protein-coupled) activity modifying protein 1 (RAMP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RAMP1 (NM_005855) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_005855
Insert Size 353 bp
Sequence Data
>SC204571 3’UTR clone of NM_005855
The sequence shown below is from the reference sequence of NM_005855. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGAGCAAGCGCACTGAGGGCATTGTGTAGGCGGGGCCCAGGCTGCCCGCGGGTGCACCCAGGCTGCAG
GGTGAGGCCAGGCAGGCCTGGGTAGGGGCAGCTTCTGGAGCCTTGGGACAGAGCAGGCCCACAATGCCC
CCCTTCTTCCAGCCAAGAAGAGCTCACAGGAGTCCAGAGTAGCCGAGGCTCTGGTATTAACCTGGAAGC
CCCCCTGGCTGGAGGCCACCGCCACCCTAGGAAGGGGGCAGGGACGTGACCTTGACTTACCTCTGGAAA
GGGTCCCAGCCTAGACTGCTTACCCCATAGCCACATTTGTGGATGAGTGGTTTGTGATTAAAAGGGATG
TTCTTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005855.4
Summary The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP1) protein, CRLR functions as a CGRP receptor. The RAMP1 protein is involved in the terminal glycosylation, maturation, and presentation of the CGRP receptor to the cell surface. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Locus ID 10267
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...