LBP (NM_004139) Human 3' UTR Clone

CAT#: SC204559

3' UTR clone of lipopolysaccharide binding protein (LBP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LBP (NM_004139) Human 3' UTR Clone
Vector pMirTarget
Synonyms BPIFD2
ACCN NM_004139
Insert Size 374 bp
Sequence Data
>SC204559 3’UTR clone of NM_004139
The sequence shown below is from the reference sequence of NM_004139. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTGCCAATGTCCAATACATGAGAGTTTGAGGACAAGAAAGATGAAGCTTGGAGGTCACAGCTGGATCT
GCTTGTTGCATTTCCAGCTGTGCAGCACGTCTCAGAGATTCTTGAAGAATGAAGACATTTCTGCTCTCA
GCTCCGGGGGTGAGGTGTGCCTGGCCTCTGCCTCCACCCTCCTCCTCTTCACCAGGTGCATGCATGCCC
TCTCTGAGTCTGGACTTTGCTTCCCCTCCAGGAGGGACCACCCTCCCCGACTGGCCTGGGATATCTTTA
CAAGCAGGCACTGTATTTTTTTATTCGCCATCTGATCCCCATGCCTAGCAGAGTGCTGGCACTTAGTAG
GTCCTCAATAAATATTTATTAAATGATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004139.5
Synonyms BPIFD2
Summary The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]
Locus ID 3929
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...