Adenine Nucleotide Translocator 2 (SLC25A5) (NM_001152) Human 3' UTR Clone

CAT#: SC204503

3' UTR clone of solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) member 5 (SLC25A5) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Adenine Nucleotide Translocator 2 (SLC25A5) (NM_001152) Human 3' UTR Clone
Vector pMirTarget
Synonyms 2F1; AAC2; ANT2; T2; T3
ACCN NM_001152
Insert Size 368 bp
Sequence Data
>SC204503 3’UTR clone of NM_001152
The sequence shown below is from the reference sequence of NM_001152. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGTATGATGAAATCAAGAAGTACACATAAGTTATTTCCTAGGATTTTTCCCCCTGTGAACAGGCATGT
TGTATTATATAACATATCTTGAGCATTCTTGACAGACTCCTGGCTGTCAGTTTCTCAGTGGCAACTATT
TACTGGTTGAAAATGGGAAGCAATAATATTCATCTGACCAGTTTTCTCTTAAAGCCATTTCCATGATGA
TGATGATGGGACTCAATTGTATTTTTTATTTCAGTCACTCCTGATAAATAACAAATTTGGAGAAATAAA
AATATCTAAAATAAATTTTGTCTGCAGTATATTTTCATATAAAAATGCATATTTGAGTGCTACATTCGA
ATAAATACTACCTTTTTAGTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001152.5
Synonyms 2F1; AAC2; ANT2; T2; T3
Summary This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Suppressed expression of this gene has been shown to induce apoptosis and inhibit tumor growth. The human genome contains several non-transcribed pseudogenes of this gene.[provided by RefSeq, Jun 2013]
Locus ID 292
MW 14.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Adenine Nucleotide Translocator 2产品

Customer Reviews 
Loading...