ARMET (MANF) (NM_006010) Human 3' UTR Clone

CAT#: SC204489

3' UTR clone of mesencephalic astrocyte-derived neurotrophic factor (MANF) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ARMET (MANF) (NM_006010) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARMET; ARP
ACCN NM_006010
Insert Size 338 bp
Sequence Data
>SC204489 3’UTR clone of NM_006010
The sequence shown below is from the reference sequence of NM_006010. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGCAGCCAGTGCACGGACCGATTTGTAGTCTGCTCAATCTCTGTTGCACCTGAGGGGGAAAAAACAG
TTCAACTGCTTACTCCCAAAACAGCCTTTTTGTAATTTATTTTTTAAGTGGGCTCCTGACAATACTGTA
TCAGATGTGAAGCCTGGAGCTTTCCTGATGATGCTGGCCCTACAGTACCCCCATGAGGGGATTCCCTTC
CTTCTGTTGCTGGTGTACTCTAGGACTTCAAAGTGTGTCTGGGATTTTTTTATTAAAGAAAAAAAATTT
CTAGCTGTCCTTGCAGAATTATAGTGAATACCAAAATGGGGTTTTGCCCCAGGAGGCTCCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006010.6
Synonyms ARMET; ARP
Summary The protein encoded by this gene is localized in the endoplasmic reticulum (ER) and golgi, and is also secreted. Reducing expression of this gene increases susceptibility to ER stress-induced death and results in cell proliferation. Activity of this protein is important in promoting the survival of dopaminergic neurons. The presence of polymorphisms in the N-terminal arginine-rich region, including a specific mutation that changes an ATG start codon to AGG, have been reported in a variety of solid tumors; however, these polymorphisms were later shown to exist in normal tissues and are thus no longer thought to be tumor-related. [provided by RefSeq, Apr 2014]
Locus ID 7873
MW 12.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...