SMOX (NM_175839) Human 3' UTR Clone

CAT#: SC204433

3' UTR clone of spermine oxidase (SMOX) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SMOX (NM_175839) Human 3' UTR Clone
Vector pMirTarget
Synonyms C20orf16; PAO; PAO-1; PAO1; PAOH; PAOH1; SMO
ACCN NM_175839
Insert Size 350 bp
Sequence Data
>SC204433 3’UTR clone of NM_175839
The sequence shown below is from the reference sequence of NM_175839. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACCGAGACCTCTTCCAGCAGGGGACCTGAGGGCTGTCCTCGCTGCTGAGAAGAGCCACTAACTCGTGA
CCTCCAGCCTGCCCCTTGCTGCCGTGTGCTCCTGCCTTCCTGATCCTCTGTAGAAAGGATTTTTATCTT
CTGTAGAGCTAGCCGCCCTGACTGCCTTCAGACCTGGCCCTGTAGCTTTTCTTTTTCTCCAGGCTGGGC
CGTGAGCAGGTGGGCCGTTGAGTTACCTCTGTGCTGGATCCCGTGCCCCCACTTGCCTACCCTCTGTCC
TGCCTTGTTATTGTAAGTGCCTTCAATACTTTGCATTTTGGGATAATAAAAAAGGCTCCCTCCCCTGCC
CCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_175839.3
Synonyms C20orf16; PAO; PAO-1; PAO1; PAOH; PAOH1; SMO
Summary Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
Locus ID 54498
MW 12.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...