HLA DMB (HLA-DMB) (NM_002118) Human 3' UTR Clone

CAT#: SC204424

3' UTR clone of major histocompatibility complex class II DM beta (HLA-DMB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HLA DMB (HLA-DMB) (NM_002118) Human 3' UTR Clone
Vector pMirTarget
Synonyms D6S221E; RING7
ACCN NM_002118
Insert Size 365 bp
Sequence Data
>SC204424 3’UTR clone of NM_002118
The sequence shown below is from the reference sequence of NM_002118. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATTATTCAGAAGGATGGCACATTTCCTAGAGGCAGAATCCTACAACTTCCACTCCAAGTGAGAAGGAG
ATTCAAACTCAATGATGCTACCATGCCTCTCCAACATCTTCAACCCCCTGACATTATCTTGGATCCTAT
GGTTTCTCCATCCAATTCTTTGAATTTCCCAGTCTCCCCTATGTAAAACTTAGCAACTTGGGGGACCTC
ATTCCTGGGACTATGCTGTAACCAAATTATTGTCCAAGGCTATATTTCTGGGATGAATATAATCTGAGG
AAGGGAGTTAAAGACCCTCCTGGGGCTCTCAGTGTGCCATAGAGGACAGCAACTGGTGATTGTTTCAGA
GAAATAAACTTTGGTGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002118.5
Synonyms D6S221E; RING7
Summary HLA-DMB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta (DMB) chain, both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP (class II-associated invariant chain peptide) molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Locus ID 3109
MW 13.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...