CD33 (NM_001772) Human 3' UTR Clone

CAT#: SC204405

3' UTR clone of CD33 molecule (CD33) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD33 (NM_001772) Human 3' UTR Clone
Vector pMirTarget
Synonyms p67; SIGLEC-3; SIGLEC3
ACCN NM_001772
Insert Size 358 bp
Sequence Data
>SC204405 3’UTR clone of NM_001772
The sequence shown below is from the reference sequence of NM_001772. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCGAATACTCAGAGGTCAGGACCCAGTGAGGAACCCACAAGAGCATCAGGCTCAGCTAGAAGATCCAC
ATCCTCTACAGGTCGGGGACCAAAGGCTGATTCTTGGAGATTTAACACCCCACAGGCAATGGGTTTATA
GACATTATGTGAGTTTCCTGCTATATTAACATCATCTTAGACTTTGCAAGCAGAGAGTCGTGGAATCAA
ATCTGTGCTCTTTCATTTGCTAAGTGTATGATGTCACACAAGCTCCTTAACCTTCCATGTCTCCATTTT
CTTCTCTGTGAAGTAGGTATAAGAAGTCCTATCTCATAGGGATGCTGTGAGCATTAAATAAAGGTACAC
ATGGAAAACACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001772.4
Synonyms p67; SIGLEC-3; SIGLEC3
Summary Sialic-acid-binding immunoglobulin-like lectin (Siglec) that plays a role in mediating cell-cell interactions and in maintaining immune cells in a resting state (PubMed:10611343, PubMed:15597323, PubMed:11320212). Preferentially recognizes and binds alpha-2,3- and more avidly alpha-2,6-linked sialic acid-bearing glycans (PubMed:7718872). Upon engagement of ligands such as C1q or syalylated glycoproteins, two immunoreceptor tyrosine-based inhibitory motifs (ITIMs) located in CD33 cytoplasmic tail are phosphorylated by Src-like kinases such as LCK (PubMed:28325905, PubMed:10887109). These phosphorylations provide docking sites for the recruitment and activation of protein-tyrosine phosphatases PTPN6/SHP-1 and PTPN11/SHP-2 (PubMed:10556798, PubMed:10206955, PubMed:10887109). In turn, these phosphatases regulate downstream pathways through dephosphorylation of signaling molecules (PubMed:10206955, PubMed:10887109). One of the repressive effect of CD33 on monocyte activation requires phosphoinositide 3-kinase/PI3K (PubMed:15597323).[UniProtKB/Swiss-Prot Function]
Locus ID 945
MW 13.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...