TRIF (TICAM1) (NM_182919) Human 3' UTR Clone

CAT#: SC204386

3' UTR clone of toll-like receptor adaptor molecule 1 (TICAM1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TRIF (TICAM1) (NM_182919) Human 3' UTR Clone
Vector pMirTarget
Synonyms IIAE6; MyD88-3; PRVTIRB; TICAM-1; TRIF
ACCN NM_182919
Insert Size 337 bp
Sequence Data
>SC204386 3’UTR clone of NM_182919
The sequence shown below is from the reference sequence of NM_182919. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCGAGGACAAGACGCAGGAGGCAGAATGACCGCGTGTCCTTGCCTGACCACCTGGGGAACACCCCTGG
ACCCAGGCATCGGCCAGGACCCCATAGAGCACCCCGGTCTGCCCTGTGCCCTGTGGACAGTGGAAGATG
AGGTCATCTGCCACTTTCAGGACATTGTCCGGGAGCCCTTCATTTAGGACAAAACGGGCGCGATGATGC
CCTGGCTTTCAGGGTGGTCAGAACTGGATACGGTGTTTACAATTCCAATCTCTCTATTTCTGGGTGAAG
GGTCTTGGTGGTGGGGGTATTGCTACGGTCTTTTAATTATAATAAATATTTATTGAATGCT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182919.4
Synonyms IIAE6; MyD88-3; PRVTIRB; TICAM-1; TRIF
Summary This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. Mutations in this gene are associated with encephalopathy, acute, infection-induced. [provided by RefSeq, Jul 2020]
Locus ID 148022
MW 12.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...