HYAL4 (NM_012269) Human 3' UTR Clone

CAT#: SC204334

3' UTR clone of hyaluronoglucosaminidase 4 (HYAL4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HYAL4 (NM_012269) Human 3' UTR Clone
Vector pMirTarget
Synonyms CSHY; HYAL-4
ACCN NM_012269
Insert Size 356 bp
Sequence Data
>SC204334 3’UTR clone of NM_012269
The sequence shown below is from the reference sequence of NM_012269. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTAGCAAGTTATCGAAGCATTCAGTTGTGAGATAATTGAGTTTAAAGGGAATTGTGTGGCCTCTAGCCT
AGTCATTTAAAGAAGGATGTAACTTATAACATTTTTTTTCTCTTATGAATTCTATTGAGAGATATTATA
AGTAGACATTATGTATGTCACTTAACATAAACAGAAACATTATTTTATTTGCCTCCAGTCTGGCTAGGA
AACCAGATCTGGGGTAAAGTCAATGTACACTTCCTCCTTATTGGAATATTTAAGTTGCATTTAAACTAA
AACTAGTATAATTTAGTCTTTTCATGAATGTACATACATAAAATTATACATAAAAATATTAAATTATTC
ATTTCAAAGAC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012269.3
Synonyms CSHY; HYAL-4
Summary This gene encodes a protein which is similar in structure to hyaluronidases but lacks hyaluronidase activity. The encoded protein acts as a chondroitin-sulfate-specific endo-beta-N-acetylgalactosaminidase; that is, it exhibits hydrolytic activity toward chondroitin sulfate chains and degrades them into oligosaccharides. Proteoglycans are formed by the covalent linkage of chondroitin sulfate chains to protein. Proteoglycans are ubiquitous components of the extracellular matrix of connective tissues and are also found at the surface of many cell types where they participate in a variety of cellular processes such as cell proliferation, differentiation, migration, cell-cell recognition, extracellular matrix deposition, and tissue morphogenesis. The expression of this gene is highest in testes and placenta. [provided by RefSeq, Apr 2019]
Locus ID 23553
MW 14
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...