PSG9 (NM_002784) Human 3' UTR Clone

CAT#: SC204324

3' UTR clone of pregnancy specific beta-1-glycoprotein 9 (PSG9) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PSG9 (NM_002784) Human 3' UTR Clone
Vector pMirTarget
Synonyms PS34; PSBG-9; PSBG-11; PSG11; PSGII
ACCN NM_002784
Insert Size 357 bp
Sequence Data
>SC204324 3’UTR clone of NM_002784
The sequence shown below is from the reference sequence of NM_002784. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATGGAGACCTGACAGAGTCTCAGTCATGACTGCAACAACTGAGACACTGAGAAAAAGAACAGGCTGAT
ACCTTCATGAAATTCAAGACAAAGAAGAAAAAAACTCAATGTTATTGGACTAAATAATCAAAAGGATAA
TGTTTTCATAATTTTTTATTGGAAAATGTGCTGATTCTTTGAATGTTTTATTCTCCAGATTTATGAACT
TTTTTTCTTCAGCAATTGGTAAAGTATACTTTTGTAAACAAAAATTGAAATATTTGCTTTTGCTGTCTA
TCTGAATGCCCCAGAATTGTGAAACTATTCATGAGTATTCATAGGTTTATGGTAATAAAGTTATTTGCA
CATGTTCCGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002784.5
Synonyms PS34; PSBG-9; PSBG-11; PSG11; PSGII
Summary The protein encoded by this gene is a member of the pregnancy-specific glycoprotein (PSG) family. This protein family and the closely related carcinoembryonic antigen cell adhesion molecule (CEACAM) gene family are both members of the immunoglobulin superfamily, and are organized as a large gene cluster. This protein is thought to inhibit platelet-fibrinogen interactions. Several studies suggest that reduced serum concentrations of PSGs are associated with fetal growth restrictions, while up-regulation of this gene has been observed in colorectal cancers. Several pseudogenes of this gene are found on chromosome 19. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014]
Locus ID 5678
MW 14.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...