Glutathione S Transferase theta 2 (GSTT2) (NM_000854) Human 3' UTR Clone

CAT#: SC204309

3' UTR clone of glutathione S-transferase theta 2 (GSTT2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Glutathione S Transferase theta 2 (GSTT2) (NM_000854) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_000854
Insert Size 356 bp
Sequence Data
>SC204309 3’UTR clone of NM_000854
The sequence shown below is from the reference sequence of NM_000854. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGCTGCTTCGAATCGCCAGGATCCCCTGAAGGGTCTGGGATGGGGGCCAGGAGATTAGCAACAAGGAT
TCATTCTGTTACTTACTTGCCCCTTTTTATCTTTCCCTCTTGCCCCAGTCCCTTCTCTCCAGCTTCATG
TGAAGCTCTGCACAGACAAGACACTCAGTGTCCTTGGCAGTGCTGCTACTCCTCAGGTGCAGCATACAT
AACCAGTAAGAGACTAAATCTGCAATATATAAAGAGCTCCTACAAATCAGTAACATGAAGAACACTCAA
AAATTGGCAAATGTCATCAGTGTTTTAAACAGAATAAAGATTCCAAACACTTTGAATAGAGAAAAAAAA
AAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000854.4
Summary The protein encoded by this gene, glutathione S-transferase (GST) theta 2 (GSTT2), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT2 and GSTT2B are nearly identical to each other, and share 55% amino acid identity with GSTT1. All three genes may play a role in human carcinogenesis. The GSTT2 gene is a pseudogene in some populations. [provided by RefSeq, Sep 2015]
Locus ID 2953
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...