Granulin (GRN) (NM_002087) Human 3' UTR Clone

CAT#: SC204271

3' UTR clone of granulin (GRN) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Granulin (GRN) (NM_002087) Human 3' UTR Clone
Vector pMirTarget
Synonyms CLN11; GEP; GP88; PCDGF; PEPI; PGRN
ACCN NM_002087
Insert Size 338 bp
Sequence Data
>SC204271 3’UTR clone of NM_002087
The sequence shown below is from the reference sequence of NM_002087. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGGACCCAGCCTTGAGACAGCTGCTGTGAGGGACAGTACTGAAGACTCTGCAGCCCTCGGGACCCCAC
TCGGAGGGTGCCCTCTGCTCAGGCCTCCCTAGCACCTCCCCCTAACCAAATTCTCCCTGGACCCCATTC
TGAGCTCCCCATCACCATGGGAGGTGGGGCCTCAATCTAAGGCCTTCCCTGTCAGAAGGGGGTTGTGGC
AAAAGCCACATTACAAGCTGCCATCCCCTCCCCGTTTCAGTGGACCCTGTGGCCAGGTGCTTTTCCCTA
TCCACAGGGGTGTTTGTGTGTGTGCGCGTGTGCGTTTCAATAAAGTTTGTACACTTTCTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002087.4
Synonyms CLN11; GEP; GP88; PCDGF; PEPI; PGRN
Summary Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
Locus ID 2896
MW 12
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...