KMT2B (NM_014727) Human 3' UTR Clone

CAT#: SC204245

3' UTR clone of myeloid/lymphoid or mixed-lineage leukemia 4 (MLL4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KMT2B (NM_014727) Human 3' UTR Clone
Vector pMirTarget
Synonyms CXXC10; DYT28; HRX2; MLL1B; MLL2; MLL4; TRX2; WBP-7; WBP7
ACCN NM_014727
Insert Size 351 bp
Sequence Data
>SC204245 3’UTR clone of NM_014727
The sequence shown below is from the reference sequence of NM_014727. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCAAGCGCTGCCGTCGGTTCCTTAACTGAGGCCGTGGCTGCCCACCACGACCCCTCACACCTCCTGCT
GCCGTCGCTGCCATCTTGCCCCTAGCCTGGGGGCTCCCTAGCCCCTCCCAGAGCATCTCACCCCCACCC
TCATGTTCAGGGTGGATGTGGGCATGCAGGTGACAAGGGCCCTGCCTCCACCCCTCCAGCCCATCCAGC
AATCGCCCCCTTTCTGCCCTGGGGGCCCAGGATGTAGATATTGTACAAAGGTTTCTAAATCCCTTCTTT
TCTATGCACTTTTTTATTTAAGAGGTGGGGTCCCAGGTGGGAACCCCCCCACAATAAAGTCTGTCAATG
TTTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014727.3
Synonyms CXXC10; DYT28; HRX2; MLL1B; MLL2; MLL4; TRX2; WBP-7; WBP7
Summary This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
Locus ID 9757
MW 12.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...