GGT5 (NM_001099781) Human 3' UTR Clone

CAT#: SC204210

3' UTR clone of gamma-glutamyltransferase 5 (GGT5) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GGT5 (NM_001099781) Human 3' UTR Clone
Vector pMirTarget
Synonyms GGL; GGT-REL; GGT 5; GGTLA1
ACCN NM_001099781
Insert Size 363 bp
Sequence Data
>SC204210 3’UTR clone of NM_001099781
The sequence shown below is from the reference sequence of NM_001099781. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAAGAGTGGGGAGGCCGCAGGCTACTAAGACACTGCTCTGCCCAGAGCTGAAGTCTGGCCCCACCAT
GAGTCCTGTGTCCAGGCCGGACATGGCTGGGGGACCAACTACTCTGGCAGGATCTGGACCCCTGGCAGG
GGAGTCCAGCTGAGAGTGGAAGAGGTGGCGGGGACCAGCTGGGCAGATGAGAGGCTGAGCCTCATCCCT
AACCCCCTTTCCCAGAGCCCCTGGTGGTCCTGAACCGGCCCCTCTATCCCTCCGCAGGCCTCTTGCCTG
GGGCCACTCTCCCACCCTCTCGATCTGTATATCCTCCAGTCCAAGATTAAAGAGGCGGACTGTGGCCTG
AAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001099781.2
Synonyms GGL; GGT-REL; GGT 5; GGTLA1
Summary This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Locus ID 2687
MW 13.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...