beta III Tubulin (TUBB3) (NM_006086) Human 3' UTR Clone

CAT#: SC204188

3' UTR clone of tubulin beta 3 (TUBB3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name beta III Tubulin (TUBB3) (NM_006086) Human 3' UTR Clone
Vector pMirTarget
Synonyms beta-4; CDCBM; CDCBM1; CFEOM3; CFEOM3A; FEOM3; TUBB4
ACCN NM_006086
Insert Size 323 bp
Sequence Data
>SC204188 3’UTR clone of NM_006086
The sequence shown below is from the reference sequence of NM_006086. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAGTCGGAGGCCCAGGGCCCCAAGTGAAGCTGCTCGCAGCTGGAGTGAGAGGCAGGTGGCGGCCGG
GGCCGAAGCCAGCAGTGTCTAAACCCCCGGAGCCATCTTGCTGCCGACACCCTGCTTTCCCCTCGCCCT
AGGGCTCCCTTGCCGCCCTCCTGCAGTATTTATGGCCTCGTCCTCCCCACCTAGGCCACGTGTGAGCTG
CTCCTGTCTCTGTCTTATTGCAGCTCCAGGCCTGACGTTTTACGGTTTTGTTTTTTACTGGTTTGTGTT
TATATTTTCGGGGATACTTAATAAATCTATTGCTGTCAGATACCCTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006086.4
Synonyms beta-4; CDCBM; CDCBM1; CFEOM3; CFEOM3A; FEOM3; TUBB4
Summary This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010]
Locus ID 10381
MW 11.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...