TPSAB1 (NM_003294) Human 3' UTR Clone

CAT#: SC204130

3' UTR clone of tryptase alpha/beta 1 (TPSAB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TPSAB1 (NM_003294) Human 3' UTR Clone
Vector pMirTarget
Synonyms TPS1; TPS2; TPSB1; TPSB2; Tryptase-2
ACCN NM_003294
Insert Size 344 bp
Sequence Data
>SC204130 3’UTR clone of NM_003294
The sequence shown below is from the reference sequence of NM_003294. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCCACCACTATGTCCCCAAAAAGCCGTGAGTCAGGCCTGGGTTGGCCACCTGGGTCACTGGAGGACCA
ACCCCTGCTGTCCAAAACACCACTGCTTCCTACCCAGGTGGCGACTGCCCCCCACACCTTCCCTGCCCC
GTCCTGAGTGCCCCTTCCTGTCCTAAGCCCCCTGCTCTCTTCTGAGCCCCTTCCCCTGTCCTGAGGACC
CTTCCCTATCCTGAGCCCCCTTCCCTGTCCTAAGCCTGACGCCTGCACCGGGCCCTCCAGCCCTCCCCT
GCCCAGATAGCTGGTGGTGGGCGCTAATCCTCCTGAGTGCTGGACCTCATTAAAGTGCATGGAAATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003294.4
Synonyms TPS1; TPS2; TPSB1; TPSB2; Tryptase-2
Summary Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, alpha and beta 1. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
Locus ID 7177
MW 11.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...