FATP2 (SLC27A2) (NM_001159629) Human 3' UTR Clone

CAT#: SC204121

3' UTR clone of solute carrier family 27 (fatty acid transporter) member 2 (SLC27A2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FATP2 (SLC27A2) (NM_001159629) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACSVL1; FACVL1; FATP2; hFACVL1; HsT17226; VLACS; VLCS
ACCN NM_001159629
Insert Size 319 bp
Sequence Data
>SC204121 3’UTR clone of NM_001159629
The sequence shown below is from the reference sequence of NM_001159629. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCATAAGTGCTAAAACCCTGAAACTCTGAATATTCCCAGGAGGATAACTCAACATTTCCAGAAAGAAA
CTGAATGGACAGCCACTTGATATAATCCAACTTTAATTTGATTGAAGATTGTGAGGAAATTTTGTAGGA
AATTTGCATACCCGTAAAGGGAGACTTTTTTAAATAACAGTTGAGTCTTTGCAAGTAAAAAGATTTAGA
GATTATTATTTTTCAGTGTGCACCTACTGTTTGTATTTGCAAACTGAGCTTGTTGGAGGGAAGGCATTA
TTTTTTAAAATACTTAGTAAATTAAATGAACACCAACATGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001159629.2
Synonyms ACSVL1; FACVL1; FATP2; hFACVL1; HsT17226; VLACS; VLCS
Summary The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Locus ID 11001
MW 12.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...