CRSP9 (MED7) (NM_001100816) Human 3' UTR Clone

CAT#: SC204001

3' UTR clone of mediator complex subunit 7 (MED7) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CRSP9 (MED7) (NM_001100816) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARC34; CRSP9; CRSP33
ACCN NM_001100816
Insert Size 336 bp
Sequence Data
>SC204001 3’UTR clone of NM_001100816
The sequence shown below is from the reference sequence of NM_001100816. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTAATTGATGAGATGAATGAAAGACCATGAAAGATGTTTCTTTTTCTTTTTTTCCTTTTGATAATAGCA
TCATATATTAGTTCATTTTCTTTTGGACAGTCTTAAGAGAAGTTTCACTAAAAATGTAAACAGCTTTAA
TCTTGACTCCAAATTTTTCAATTATGAGATGTCATAGGCAGTAATTTCGCTGTATAACAAGCATAGACA
AATGAGTGTCCCTGCACTAAGAAGAATCACTTTAAAAAGCAAAGTGTTAGCTGCTGTTGTATGGGACAT
TCCTATGTTTTAGAGTTGCAGTAAAACTTTGATGATAACCTCAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001100816.1
Synonyms ARC34; CRSP9; CRSP33
Summary The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 9443
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...