Integrin beta 4 binding protein (EIF6) (NM_002212) Human 3' UTR Clone

CAT#: SC203993

3' UTR clone of eukaryotic translation initiation factor 6 (EIF6) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Integrin beta 4 binding protein (EIF6) (NM_002212) Human 3' UTR Clone
Vector pMirTarget
Synonyms b(2)gcn; CAB; eIF-6; EIF3A; ITGB4BP; p27(BBP); p27BBP
ACCN NM_002212
Insert Size 309 bp
Sequence Data
>SC203993 3’UTR clone of NM_002212
The sequence shown below is from the reference sequence of NM_002212. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGGATTCCCTCATTGACAGCCTCACCTGAGTCACCTTCCAAGTTGTTCCATGGGCTCCTGGCTCTGGA
CTGTGGCCAACCTTCTCCACATTCCGCCCAATCTGTACCGGATGCTGGCAGGGAGGTGGCAGAGAGCTC
ACTGGGACTGAGGGGCTGGGCACCCAACCCTTTTCCACCTGTGCTTATCGCCTGGATCTATCATTACTG
CAAAAACCTGCTCTGTTGTGCTGGCTGGCAGGCCCTGTGGCTGCTGGCTGAGGGTTCTGCTGTCCTGTG
CCACCCCATTAAAGTGCAGTTCCCTCCGGGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002212.4
Synonyms b(2)gcn; CAB; eIF-6; EIF3A; ITGB4BP; p27(BBP); p27BBP
Summary Hemidesmosomes are structures which link the basal lamina to the intermediate filament cytoskeleton. An important functional component of hemidesmosomes is the integrin beta-4 subunit (ITGB4), a protein containing two fibronectin type III domains. The protein encoded by this gene binds to the fibronectin type III domains of ITGB4 and may help link ITGB4 to the intermediate filament cytoskeleton. The encoded protein, which is insoluble and found both in the nucleus and in the cytoplasm, can function as a translation initiation factor and prevent the association of the 40S and 60S ribosomal subunits. Multiple non-protein coding transcript variants and variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Locus ID 3692
MW 10.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Integrin beta 4 binding protein产品

Customer Reviews 
Loading...