ErbB 3 (ERBB3) (NM_001005915) Human 3' UTR Clone

CAT#: SC203987

3' UTR clone of v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3) transcript variant s for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ErbB 3 (ERBB3) (NM_001005915) Human 3' UTR Clone
Vector pMirTarget
Synonyms c-erbB-3; c-erbB3; ErbB-3; erbB3-S; FERLK; HER3; LCCS2; MDA-BF-1; p45-sErbB3; p85-sErbB3; p180-ErbB3
ACCN NM_001005915
Insert Size 335 bp
Sequence Data
>SC203987 3’UTR clone of NM_001005915
The sequence shown below is from the reference sequence of NM_001005915. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGTGCCTGTCACCTTGGCCGCTGTCTAAAGGTCCATTGCTCCCTAAGCAATAGAGGGCCCCCAGTAG
GGGGAGCTAGGGGCATCTGCTCCAGGGAAAGGAACCCTGTGTCCTTGTGGGGCTGGAGTCAGAGCTGGA
TCTGTTAACCGTTTTTCTAATTTCAAAGTACAGTGTACCGGAGGCCAGGCCTGATGGCTTACACCTGTA
ATCCCAGCATTTTGGGAGGCCAAGGAGGGCAGATCACTTGAGATCAGGAGTTTGAGACCAGCCTGGCCA
ACATGGCGAAACCCTGTCTCTACTAAAAATACAAAAAAATAAAATAAAATAAAAAATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001005915.1
Synonyms c-erbB-3; c-erbB3; ErbB-3; erbB3-S; FERLK; HER3; LCCS2; MDA-BF-1; p45-sErbB3; p85-sErbB3; p180-ErbB3
Summary This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Locus ID 2065
MW 11.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...