ULK2 (NM_001142610) Human 3' UTR Clone

CAT#: SC203984

3' UTR clone of unc-51-like kinase 2 (C. elegans) (ULK2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ULK2 (NM_001142610) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATG1B; Unc51.2
ACCN NM_001142610
Insert Size 308 bp
Sequence Data
>SC203984 3’UTR clone of NM_001142610
The sequence shown below is from the reference sequence of NM_001142610. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCGCTCTGCCATAGCACCGCAACCGTGTGAGCAGCAGGCTCATCCCGTGGACCGGTGGTGGGAACGTGA
GGAAGAGGGGAAGGAAGGAAGAGCTTTTCCATTTGGTGCTCCAATGTCTCCTGCTGGACCCATCTGCCT
AGTGGAAGGCAGCAAAATTTCAAGAAACAGGTGAGGTTGAGCAGCTTGGTGCAACCCCATGGGGCCTGG
AGTTGGAGCTCAACAGCAATGGATTTCAGAGACCACCCTGAAACTCCCAGTAAAAAAGACTTGGGAGAC
ATGTTAATAAACTCAAGCATTTGATCGACCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001142610.2
Synonyms ATG1B; Unc51.2
Summary This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
Locus ID 9706
MW 11.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...