ENSA (NM_207168) Human 3' UTR Clone

CAT#: SC203942

3' UTR clone of endosulfine alpha (ENSA) transcript variant 8 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ENSA (NM_207168) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARPP-19e
ACCN NM_207168
Insert Size 316 bp
Sequence Data
>SC203942 3’UTR clone of NM_207168
The sequence shown below is from the reference sequence of NM_207168. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACAGAAGTAGAGGCGAATTTGAAATTTGAAAAGAGCAAGTCAAATTAATGTAAATCCCTGATGTGGTA
TCAATTCCCTCCTGATTTCCCATGTAGGAAATTAAGGCCTAAATTGGAGCATTTGGGTGTGTGGGGAAA
TGAGGGAAAGATGTTAGAAACTGAAATGCAGACTGCCCCCAGGCATTTGCCTGTTTGAATGTTGGAGGT
TTTAGGATTGTGCACTTTTTAAGCATTAGAGATAAATTTTGGGATGCATCATTTCAGAAGAAGATCAAA
CCATCTCTCCTACAGAAATAAATCCTCAACTTGAAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207168.2
Synonyms ARPP-19e
Summary The protein encoded by this gene belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein was identified as an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane of pancreatic beta cells and plays a key role in the control of insulin release from pancreatic beta cells. This protein is thought to be an endogenous regulator of KATP channels. In vitro studies have demonstrated that this protein modulates insulin secretion through the interaction with KATP channel, and this gene has been proposed as a candidate gene for type 2 diabetes. At least eight alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Locus ID 2029
MW 11.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...