IGSF8 (NM_052868) Human 3' UTR Clone

CAT#: SC203903

3' UTR clone of immunoglobulin superfamily member 8 (IGSF8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IGSF8 (NM_052868) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD81P3; CD316; EWI-2; EWI2; KCT-4; LIR-D1; PGRL
ACCN NM_052868
Insert Size 311 bp
Sequence Data
>SC203903 3’UTR clone of NM_052868
The sequence shown below is from the reference sequence of NM_052868. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCTTCATGAAGAGGCTTCGAAAACGGTGATCCCTTACTCCCCAGGTCTTGCAGGTGTCGACTGTCTTC
CGGCCCAGCTCCAAGCCCTCCTCTGGTTGCCTGGACACCCTCTCCCTCTGTCCACTCTTCCTTTAATTT
ATTTGACCTCCCACTACCCAGAATGGGAGACGTGCCTCCCCTTCCCCACTCCTTCCCTCCCAAGCCCCT
CCCTCTGGCCTTCTGTTCTTGATCTCTTAGGGATCCTATAGGGAGGCCATTTCCTGTCCTGGAATTAGT
TTTTCTAAAATGTGAATAAACTTGTTTTATAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_052868.6
Synonyms CD81P3; CD316; EWI-2; EWI2; KCT-4; LIR-D1; PGRL
Summary This gene encodes a member the EWI subfamily of the immunoglobulin protein superfamily. Members of this family contain a single transmembrane domain, an EWI (Glu-Trp-Ile)-motif and a variable number of immunoglobulin domains. This protein interacts with the tetraspanins CD81 and CD9 and may regulate their role in certain cellular functions including cell migration and viral infection. The encoded protein may also function as a tumor suppressor by inhibiting the proliferation of certain cancers. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Locus ID 93185
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...